BBa_I715000 1 CreA Amino Half of Cre Recombinase (aka CreA) 2007-06-26T11:00:00Z 2015-08-31T04:07:49Z BBa_J61047 The amino half of the Cre recombinase gene (BBa_J61047) was cloned into plasmid pSB1A2. This half contains the first 570 base pairs in the gene. The carboxyl half (BBa_I7165) of the Cre recombinase gene was also cloned into plasmid pSB1A2 and contains the remaining 462 base pairs of the gene. Our eventual goal was to insert a hixC site in the middle of the gene while maintaining Cre recombinase's functionality. The location of our split site was chosen based off of outside literature in which Cre Recombinase had been successfully split as well as the protein structure of Cre recombinase. false false _120_ 0 1491 9 Not in stock false None false Will DeLoache annotation1935690 1 start range1935690 1 1 3 annotation1935691 1 CreA range1935691 1 1 570 BBa_I715000_sequence 1 atgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z