BBa_I715001 1 CreB Carboxl Half of Cre Recombinase (aka CreB) 2007-06-26T11:00:00Z 2015-08-31T04:07:49Z BBa_J61047 The carboxyl half of the Cre recombinase gene (BBa_J61047) was cloned into plasmid pSB1A2. This half contains the last 462 base pairs in the gene. The amino half (BBa_I716500) of the Cre recombinase gene was also cloned into plasmid pSB1A2 and contains the first 570 base pairs of the gene. Our eventual goal is to insert a hixC site in the middle of the gene while maintaining Cre recombinase's functionality. The location of our split site was chosen based off of outside literature that demonstrated the successful splitting of Cre Recombinase, as well as the protein structure of Cre recombinase. false false _120_ 0 1491 9 Not in stock false None false Will DeLoache annotation1935692 1 Inserted Base range1935692 1 1 1 annotation1935689 1 stop range1935689 1 461 463 annotation1935688 1 CreB range1935688 1 2 460 BBa_I715001_sequence 1 tgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z