BBa_I715003 1 BBa_I715003 hybrid pLac with UV5 mutation 2007-07-02T11:00:00Z 2015-08-31T04:07:49Z E.Coli genome This promoter sequence is a derivative of part BBa_R0011 which is a -35 and -10 recognition site with two lac operator 1's inserted in the spacer region of the RNAP recognition region and before the -35 RANP recognition region. This part utilizes the UV5 double mutation at the -10 RNAP recognition site to recruit RNAP without the help of a CAP binding region. false false _120_ 0 1761 9 Not in stock false The length of the fragment makes it cumbersome to gel purify false Michael Waters annotation1936228 1 -35 RNAP binding range1936228 1 20 25 annotation1936231 1 -10 RNAP binding range1936231 1 43 47 annotation1936230 1 lac 01 range1936230 1 26 42 annotation1936229 1 lac 01 range1936229 1 3 19 annotation1936232 1 UV5 -10 RNAP recognition region double mutation range1936232 1 43 47 BBa_I715003_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaatatgttgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z