BBa_I715023 1 RFP2 Carboxyl portion of RFP 2007-06-24T11:00:00Z 2016-01-25T04:44:49Z Sequence from part BBa_E1010. The second portion of the RFP gene, after the HixC insertion point. false false _120_ 4206 201 61 In stock false Used web tool. true Andrew Martens annotation1935382 1 extra base (avoid frameshift) range1935382 1 1 1 annotation1935383 1 Continue coding sequence range1935383 1 2 214 annotation1935384 1 (two in tandem) range1935384 1 215 219 BBa_I715023_sequence 1 tggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z