BBa_J44000 1 hixC hixC binding site for Salmonella typhimurium Hin recombinase 2006-06-05T11:00:00Z 2015-08-31T04:08:48Z Nanassy and Hughes. 1998. In Vivo Identification of Intermediate Stages of the DNA Inversion Reaction Catlyzed by the Salmonella Hin Recombinase [http://www.genetics.org/cgi/content/abstract/149/4/1649] A 26 bp sequence of DNA composed of 12 bp inverted repeats and a 2 bp core that operates in Salmonella paired with a hixR binding site to recombine DNA. A second hix site is required for recombination to occur. The two sites bind Hin recombinase in the formation of an invertasome. false true _71_ 0 606 61 In stock true Standard BioBrick prefix and suffix were added to the 26 bp sequence. true Missouri Western and Davidson Groups, Todd Eckdahl BBa_I715027 1 BBa_I715027 HixC-RFP2 2007-07-11T11:00:00Z 2015-08-31T04:07:49Z RFP2 generated from PCR primers from BBa_E1010. Created to test if RFP can tolerate a HixC insertion. This is the second portion of RPF, with a HixC before. true false _120_ 0 1620 9 Discontinued false Note that the first nucleotide is added to avoid a frameshift. Be sure to add subpart BBa_I715023. false Andrew Martens annotation1937164 1 BBa_J44000 range1937164 1 1 26 BBa_J44000_sequence 1 ttatcaaaaaccatggtttttgataa BBa_I715027_sequence 1 ttatcaaaaaccatggtttttgataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z