BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_I715058 1 BBa_I715058 HPP - B1 (DBA) + Hin 2007-11-25T12:00:00Z 2015-08-31T04:07:50Z See subparts. This part has our DBA construct downtream of the Hin expression cassette. false false _120_ 0 1491 9 Not in stock false None. false Will DeLoache component1958804 1 BBa_I715019 component1958789 1 BBa_I715020 component1958792 1 BBa_B0012 component1958799 1 BBa_I715023 component1958786 1 BBa_J44000 component1958771 1 BBa_R0085 component1958776 1 BBa_I715022 component1958746 1 BBa_R0010 component1958777 1 BBa_J44000 component1958773 1 BBa_B0034 component1958790 1 BBa_B0010 component1958785 1 BBa_I715022 component1958761 1 BBa_J31001 component1958782 1 BBa_B0034 component1958801 1 BBa_B0034 component1958754 1 BBa_B0030 component1958764 1 BBa_B0012 component1958762 1 BBa_B0010 component1958796 1 BBa_J44000 component1958805 1 BBa_J44000 component1958780 1 BBa_I715020 annotation1958805 1 BBa_J44000 range1958805 1 3474 3499 annotation1958792 1 BBa_B0012 range1958792 1 2666 2706 annotation1958796 1 BBa_J44000 range1958796 1 2715 2740 annotation1958790 1 BBa_B0010 range1958790 1 2578 2657 annotation1958782 1 BBa_B0034 range1958782 1 1798 1809 annotation1958780 1 BBa_I715020 range1958780 1 1540 1789 annotation1958773 1 BBa_B0034 range1958773 1 1018 1029 annotation1958764 1 BBa_B0012 range1958764 1 938 978 annotation1958799 1 BBa_I715023 range1958799 1 2749 2968 annotation1958801 1 BBa_B0034 range1958801 1 2977 2988 annotation1958761 1 BBa_J31001 range1958761 1 230 841 annotation1958746 1 BBa_R0010 range1958746 1 1 200 annotation1958776 1 BBa_I715022 range1958776 1 1036 1497 annotation1958771 1 BBa_R0085 range1958771 1 987 1009 annotation1958789 1 BBa_I715020 range1958789 1 2320 2569 annotation1958785 1 BBa_I715022 range1958785 1 1816 2277 annotation1958804 1 BBa_I715019 range1958804 1 2995 3465 annotation1958762 1 BBa_B0010 range1958762 1 850 929 annotation1958786 1 BBa_J44000 range1958786 1 2286 2311 annotation1958754 1 BBa_B0030 range1958754 1 209 223 annotation1958777 1 BBa_J44000 range1958777 1 1506 1531 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0085 1 BBa_R0085 T7 Consensus Promoter Sequence 2005-02-21T12:00:00Z 2015-05-08T01:14:15Z Sequence obtained from Sri Kosuri Released HQ 2013 The T7 promoter should only produce PoPS when the T7 polymerase is also being expressed. false false _11_6_ 0 135 7 In stock false false Barry Canton annotation1721522 1 Initiation Region range1721522 1 12 23 annotation1721521 1 Polymerase Binding Region range1721521 1 1 11 annotation1721520 1 Transcription Start Site range1721520 1 18 18 BBa_J31001 1 Hin LVA DNA invertase Hin tagged with LVA 2006-07-11T11:00:00Z 2015-08-31T04:08:45Z Salmonella typhimurium and the the Hin part without LVA. This part produces the Hin protein with an LVA degredation tag. We are currently looking into this as a way to ensure no Hin is floating around once we turn off the Hin promoter. false false _61_ 0 918 61 In stock true None really false Erin Zwack, Sabriya Rosemond annotation1910564 1 Hin range1910564 1 1 570 annotation1910565 1 Fwd primer J31001 range1910565 1 1 3 annotation1910570 1 Rev primer J31001 range1910570 1 551 612 annotation1910567 1 Stop codon range1910567 1 610 612 annotation1910566 1 LVA range1910566 1 571 609 BBa_I715023 1 RFP2 Carboxyl portion of RFP 2007-06-24T11:00:00Z 2016-01-25T04:44:49Z Sequence from part BBa_E1010. The second portion of the RFP gene, after the HixC insertion point. false false _120_ 4206 201 61 In stock false Used web tool. true Andrew Martens annotation1935384 1 (two in tandem) range1935384 1 215 219 annotation1935383 1 Continue coding sequence range1935383 1 2 214 annotation1935382 1 extra base (avoid frameshift) range1935382 1 1 1 BBa_I715022 1 RFP1 Amino Portion of RFP 2007-06-24T11:00:00Z 2016-01-25T04:43:58Z adf Released HQ 2013 af false false _120_ 4206 201 61 In stock false afd true Andrew Martens annotation1935381 1 Coding sequence range1935381 1 1 462 annotation1935380 1 start range1935380 1 1 3 BBa_J44000 1 hixC hixC binding site for Salmonella typhimurium Hin recombinase 2006-06-05T11:00:00Z 2015-08-31T04:08:48Z Nanassy and Hughes. 1998. In Vivo Identification of Intermediate Stages of the DNA Inversion Reaction Catlyzed by the Salmonella Hin Recombinase [http://www.genetics.org/cgi/content/abstract/149/4/1649] A 26 bp sequence of DNA composed of 12 bp inverted repeats and a 2 bp core that operates in Salmonella paired with a hixR binding site to recombine DNA. A second hix site is required for recombination to occur. The two sites bind Hin recombinase in the formation of an invertasome. false true _71_ 0 606 61 In stock true Standard BioBrick prefix and suffix were added to the 26 bp sequence. true Missouri Western and Davidson Groups, Todd Eckdahl BBa_I715019 1 GFP1 Amino Half of GFP (aka GFP1) 2007-06-21T11:00:00Z 2015-08-31T04:07:49Z A Released HQ 2013 A false false _120_ 0 1491 9 In stock false A true Will DeLoache annotation1935357 1 Coding Amino Portion GFP (aka GFP1) range1935357 1 1 471 annotation1935356 1 Start Codon range1935356 1 1 3 BBa_I715020 1 GFP2 Carboxyl Half of GFP (aka GFP2) 2007-06-21T11:00:00Z 2015-08-31T04:07:49Z A Released HQ 2013 A false false _120_ 0 1491 9 In stock false A true Will DeLoache annotation1935361 1 Coding Carboxyl half of GFP (aka GFP2) range1935361 1 1 244 annotation1935362 1 Stop Codons (two in tandem) range1935362 1 245 250 annotation1935360 1 extra base to maintain reading frame range1935360 1 1 1 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961227 1 start range1961227 1 173 173 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_I715058_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagattaaagaggagaaatactagatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttaccagtgcaaattgtgaccgcatttttgaggaccgtatcagtggcaagattgcaaaccgccccggcctgaaacgagcgttaaagtatgtaaataaaggcgatactcttgtcgtctggaaattagacagactgggccgcagcgtgaaaaacctggtggcgttaatatcagaattacatgaacgtggagctcacttccattctttaaccgatagtattgataccagtagcgcgatggggcgattcttttttcatgtaatgtcagcactggccgagatggagcgagaattaattgtcgagcgaacccttgccggactggctgccgccagagcgcaaggacgactgggagggcgccctcgggcgatcaacagacatgaacaggaacagattagtcggctattagagaaaggccatcctcggcagcaactagctattatttttggtattggcgtatctaccttatacagatattttccggcaagccgtataaaaaaacgaatgaataggcctgctgcaaacgacgaaaactacgctttagtagcttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtaatacgactcactatagggagatactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagactactagagttatcaaaaaccatggtttttgataatactagagtaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagactactagagttatcaaaaaccatggtttttgataatactagagtaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagttatcaaaaaccatggtttttgataatactagagtggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataatactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaatactagagttatcaaaaaccatggtttttgataa BBa_B0034_sequence 1 aaagaggagaaa BBa_R0085_sequence 1 taatacgactcactatagggaga BBa_I715023_sequence 1 tggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I715019_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaa BBa_J44000_sequence 1 ttatcaaaaaccatggtttttgataa BBa_B0030_sequence 1 attaaagaggagaaa BBa_I715020_sequence 1 taagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_J31001_sequence 1 atggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttaccagtgcaaattgtgaccgcatttttgaggaccgtatcagtggcaagattgcaaaccgccccggcctgaaacgagcgttaaagtatgtaaataaaggcgatactcttgtcgtctggaaattagacagactgggccgcagcgtgaaaaacctggtggcgttaatatcagaattacatgaacgtggagctcacttccattctttaaccgatagtattgataccagtagcgcgatggggcgattcttttttcatgtaatgtcagcactggccgagatggagcgagaattaattgtcgagcgaacccttgccggactggctgccgccagagcgcaaggacgactgggagggcgccctcgggcgatcaacagacatgaacaggaacagattagtcggctattagagaaaggccatcctcggcagcaactagctattatttttggtattggcgtatctaccttatacagatattttccggcaagccgtataaaaaaacgaatgaataggcctgctgcaaacgacgaaaactacgctttagtagcttaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I715022_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z