BBa_I715076 1 BBa_I715076 pLac promoter upstream of the Ec86 retron msr/msd sequence 2010-05-07T11:00:00Z 2015-08-31T04:07:50Z The Ec86 retron comes from E.coli clinical strain B This part places the Ec86 msr/msd under the transcriptional control of the lac promoter. Transcription of the Ec86 msr/msd sequence results an mRNA strand that forms a secondary structure which allows it to act as a template and primer for reverse transcription. false false _120_ 0 1761 9 Not in stock false The Ec86 msr/msd BioBrick was designed using PCR false Michael Waters component2068983 1 BBa_R0010 component2068990 1 BBa_I715072 annotation2068983 1 BBa_R0010 range2068983 1 1 200 annotation2068990 1 BBa_I715072 range2068990 1 209 381 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961224 1 -35 range1961224 1 137 142 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961227 1 start range1961227 1 173 173 annotation1961223 1 CAP binding site range1961223 1 89 126 BBa_I715072 1 Ec86 msr/m Ec86 msr/msd 2009-12-18T12:00:00Z 2015-08-31T04:07:50Z E.coli clinical strain B msr/msd overlapping region of the Ec86 retron from E.coli clinical strain B. This part codes for the region of the Ec86 retron that is transcribed as a ssDNA/RNA hybrid after reverse transcription. false false _120_ 0 1761 9 Not in stock false Ec86 BioBrick was cloned by PCR, using primers with the BioBrick prefix and suffix upstream false Michael Waters BBa_I715072_sequence 1 tatgataagattccgtatgcgcacccttagcgagaggtttatcattaaggtcaacctctggatgttgtttcggcatcctgcattgaatctgagttactgtctgttttccttgttggaacggagagcatcgcctgatgctctccgagccaaccaggaaacccgttttttctgac BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_I715076_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagtatgataagattccgtatgcgcacccttagcgagaggtttatcattaaggtcaacctctggatgttgtttcggcatcctgcattgaatctgagttactgtctgttttccttgttggaacggagagcatcgcctgatgctctccgagccaaccaggaaacccgttttttctgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z