BBa_I716105 1 PT7-wt T7 Promoter (Wild Type) 2007-06-08T11:00:00Z 2015-08-31T04:07:51Z This part was generated synthetically. This is the T7 Promoter which is activated when the T7 RNA Polymerase is produced. It provides very good PoPS (Polymerases Per Second) output, as well as it is highly orthogonal to E. Coli's natural transcription system. This is the most active (Wild Type) variation we are using. false false _110_ 0 1694 9 It's complicated false {{BerkiGEM2007-Biobrick2.0Intro}} false David Tulga annotation1954613 1 T7 Promoter Wild Type range1954613 1 1 29 BBa_I716105_sequence 1 gtataatacgactcactatagggagaggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z