BBa_I716107 1 PT7-E T7 Promoter (Mutant E) 2007-06-08T11:00:00Z 2015-08-31T04:07:51Z This part was generated synthetically. Released HQ 2013 This is the T7 Promoter which is activated when the T7 RNA Polymerase is produced. It provides very good PoPS (Polymerases Per Second) output, as well as it is highly orthogonal to E. Coli's natural transcription system. This one of the moderately active (Mutant E) variations we are using. false false _110_ 0 1694 9 In stock false {{BerkiGEM2007-Biobrick2.0Intro}} false David Tulga annotation1954611 1 T7 Promoter E range1954611 1 1 29 BBa_I716107_sequence 1 gtataatacgactcactatagaagcaggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z