BBa_I717002 1 BBa_I717002 Pr from lambda switch 2007-10-02T11:00:00Z 2015-08-31T04:07:52Z The sequence for the lambda switch was obtained from literature. This part is the right promoter from the lambda switch. It promotes to either side based on the concentration of cI and Cro proteins. false false _159_ 0 1873 9 Not in stock false The right side of the promoter has an A-T rich RBS for better expression of genes. There is also a translational stop codon six base pairs after the +1 site on the right side. false Blair Lyons annotation1945334 1 Pr and Prm from lambda switch range1945334 1 22 156 BBa_I717002_sequence 1 gaattcgcggccgcttctagagtcatgatttttcctcctattagctcatacgttaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgcatgtactaaggaggaaaaaccatggtactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z