BBa_I717014 1 BBa_I717014 TF to FP link 2009-11-19T12:00:00Z 2015-08-31T04:07:52Z http://dx.doi.org/10.1038/35014651 The fusion protein is constructed from amino terminally positioned TetR or TetRY42A, a linker (with amino-acid sequence GENLYFQSGGA) and a carboxy terminally positioned EGFP. false false _159_ 0 1485 9 Not in stock false The amino acid sequence provided by the authors was back translated to DNA sequence in SeqMan using the E.coli standard genetic code. false Jean Peccoud BBa_I717014_sequence 1 ggtgaaaacctgtacttccagtctggtggtgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z