BBa_I718002 1 BBa_I718002 Diacylglycerol-Acyl-transferase (DGAT) for triglyceride synthesis 2007-07-09T11:00:00Z 2015-08-31T04:07:52Z * Acinetobacter calcoaceticus ADP1 * Accession number: AF529086 * Kalscheuer,R. and Steinbuchel,A. A Novel Bifunctional Wax Ester Synthase/Acyl-CoA:Diacylglycerol Acyltransferase Mediates Wax Ester and Triacylglycerol Biosynthesis in Acinetobacter calcoaceticus ADP1. J. Biol. Chem. 278 (10), 8075-8082 (2003) * Which species is the enzyme from? Acinetobacter calcoaceticus ADP1 (Gram negative bacterium) * What reaction does it catalyze? diacylglycerol + acyl-coA -> triglyceride + coA-SH Studies employing total membrane fractions or extracts of recombinants E. coli strains revealed that this enzyme has a very broad substrate range, accepting long chain fatty alcohols and acyl-CoA esters ranging from C12 to C20 as well as monoacylglycerol as substrates (Kalscheuer, 2004) * Does it work in E. coli? Yes. The authors of the paper have shown that it works already in vitro after purification. * Does it require anything? Yes. DAG is already a compound of the phospholipid metabolism. E. coli has a Long Chain Fatty Acid (LCFA) transporter, FadL. Adding oleate in the LB medium (5mM) is probably needed. * The four reactions where DAG is involved: - ATP + a 1,2-diacylglycerol = ADP + an L-phosphatidate - a 1,2-diacylglycerol + CDP-choline -> a - phosphatidylcholine + CMP - an L-1-phosphatidyl-ethanolamine + KDO2-lipid IVA = a 1,2-diacylglycerol + phosphatidylethanolamine-KDO2-lipidA - an MDO-O-glucose + an L-1-phosphatidyl-glycerol = a 1,2-diacylglycerol + an MDO-6-(glycerophospho)-D-glucose * Another reactions catalyzed by DGAT? Yes. DGAT is also an acyl-CoA fatty alcohol acyltransferase (wax ester synthase, WS) catalyzing the final condensation of acyl-CoA and fatty alcohol. Knowing that E.coli does not produce fatty alcohol, this reaction is probably not avaible in this bacteria. * In vitro characterization of WS/DGAT: The molecular weight is about 53 kDa, the enzyme probably acts as homodimer (Stoevken, 2005). The highest activity was obtained at 40 - 45 ??C (Stoevken, 2005) The WS reaction follows a Michaelis - Menten kinetic but the DGAT reaction fit neither Michaelis - Menten neither cooperative enzyme kinetics (Stoevken, 2005). Palmitoyl-CoA is accepted with highest specificity (Stoevken, 2005). In Acinetobacter ADP1, the enzyme is associated with lipids inclusions but also with the membrane and a minor amount in the cytoplasm (Stoevken, 2005). In recombinant E.coli, the majority of WS/DGAT was membrane-associated but to some extent also located in the cytosolic fraction (Stoevken, 2005). false false _141_ 0 1625 9 Not in stock false We mutagenized Pst-1 site in position 1062 after ATG. We mutagenized stop codon TAAAAA into TAATAA to conform with BioBrick standards. We added in 5' a strong RBS (BBa_B0030) and prefixe biobrick (BBa_G00000). In 3', we added suffixe biobrick (BBa_G00001). false David Puyraimond annotation1956258 1 DGAT range1956258 1 25 1401 annotation1956257 1 BBa_B0030 range1956257 1 1 15 annotation1956259 1 ATG range1956259 1 25 27 annotation1956260 1 TAA range1956260 1 1399 1401 BBa_I718002_sequence 1 attaaagaggagaaaatccacgctatgcgcccattacatccgattgattttatattcctgtcactagaaaaaagacaacagcctatgcatgtaggtggtttatttttgtttcagattcctgataacgccccagacacctttattcaagatctggtgaatgatatccggatatcaaaatcaatccctgttccaccattcaacaataaactgaatgggcttttttgggatgaagatgaagagtttgatttagatcatcattttcgtcatattgcactgcctcatcctggtcgtattcgtgaattgcttatttatatttcacaagagcacagtacgctgctagatcgggcaaagcccttgtggacctgcaatattattgaaggaattgaaggcaatcgttttgccatgtacttcaaaattcaccatgcgatggtcgatggcgttgctggtatgcggttaattgaaaaatcactctcccatgatgtaacagaaaaaagtatcgtgccaccttggtgtgttgagggaaaacgtgcaaagcgcttaagagaacctaaaacaggtaaaattaagaaaatcatgtctggtattaagagtcagcttcaggcgacacccacagtcattcaagagctttctcagacagtatttaaagatattggacgtaatcctgatcatgtttcaagctttcaggcgccttgttctattttgaatcagcgtgtgagctcatcgcgacgttttgcagcacagtcttttgacctagatcgttttcgtaatattgccaaatcgttgaatgtgaccattaatgatgttgtactagcggtatgttctggtgcattacgtgcgtatttgatgagtcataatagtttgccttcaaaaccattaattgccatggttccagcctctattcgcaatgacgattcagatgtcagcaaccgtattacgatgattctggcaaatttggcaacccacaaagatgatcctttacaacgtcttgaaattatccgccgtagtgttcaaaactcaaagcaacgcttcaaacgtatgaccagcgatcagattctaaattatagtgctgtcgtatatggcccagcaggactcaacataatttctggcatgatgccaaaacgccaagccttcaatctggttatttccaatgtgcctggcccaagagagccactttactggaatggtgccaaacttgatgcactctacccagcttcaattgtattagacggtcaagcattgaatattacaatgaccagttatttagataaacttgaagttggtttgattgcatgccgtaatgcattgccaagaatgcagaatttactgacacatttagaagaagaaattcaactatttgaaggcgtaattgcaaagcaggaagatattaaaacagccaattaaaaacaataaacttgattttttaatttatcagataaaactaaagggctaaattagccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z