BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_I718012 1 BBa_I718012 ptet-lox71-ter 2007-10-25T11:00:00Z 2015-08-31T04:07:52Z none Released HQ 2013 Upstream construct of the Synthetics Multicellular Bacterium false false _141_ 0 1481 9 In stock false none false David Bikard component1956344 1 BBa_B0012 component1956337 1 BBa_R0040 component1956341 1 BBa_I718017 component1956342 1 BBa_B0010 annotation1956337 1 BBa_R0040 range1956337 1 1 54 annotation1956341 1 BBa_I718017 range1956341 1 63 96 annotation1956342 1 BBa_B0010 range1956342 1 105 184 annotation1956344 1 BBa_B0012 range1956344 1 193 233 BBa_I718017 1 lox71 lox71 2007-10-25T11:00:00Z 2015-08-31T04:07:52Z This part was generated in the form of a forward & a reverse primer. After annealing these primers EcoRI & PstI compatible cohesive ends at the 5' & 3' ends of the dsDNA were generated. Next, the dsDNA was subcloned in a pSB1A2 open plasmid (digested with EcoRI & PstI) You can follow the construction process by following the links available in the Paris iGEM 2007 wiki: http://parts.mit.edu/igem07/index.php/Paris "freezer" section plasmids table. A links sends you to the corresponding notebook date when the ligation reaction was performed Released HQ 2013 Lox71 is a site specific recombination cassette. It belongs to the loxP family frequently used in genetics, particularly in mouse genetics. lox site recombination is catalysed by a Site specific recombinase, Cre. lox sequences are composed of an 8 bp Core sequence surrounded by two Arms. The particularity of lox66 is that it has an altered sequence at the end of it's left arm compared to loxP. This sequence variation reduces affinity of the Cre recombinase for the arm. As a consequence, after a recombination between a lox71 and a lox66 (altered right arm sequence), one of the two resulting generated lox sites has very low recombination potential as it inherited both mutated arms. Use of lox71 & lox66 sites is potentially interesting when the recombination reaction must be "irreversible". false false _141_ 0 1568 9 In stock false No modifaication was made on lox71 sequence true Eimad Shotar BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I718017_sequence 1 taccgttcgtatacgatacattatacgaagttat BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I718012_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtaccgttcgtatacgatacattatacgaagttattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z