BBa_I718016 1 lox66 lox66 2007-10-25T11:00:00Z 2015-08-31T04:07:52Z This part was generated in the form of a forward & a reverse primer. After annealing these primers EcoRI & PstI compatible cohesive ends at the 5' & 3' ends of the dsDNA were generated. Next, the dsDNA was subcloned in a pSB1A2 open plasmid (digested with EcoRI & PstI) You can follow the construction process by following the links available in the Paris iGEM 2007 wiki: http://parts.mit.edu/igem07/index.php/Paris "freezer" section plasmids table. A links sends you to the corresponding notebook date when the ligation reaction was performed lox66 is a site specific recombination cassette. It belongs to the loxP family frequently used in genetics, particularily in mouse genetics. lox site recombination is catalysed by a Site specific recombinase, Cre. lox sequences are composed of an 8 bp Core sequence surrounded by two Arms. The particularity of lox66 is that it has an altered sequence at the end of it's left arm compared to loxP. This sequence variation reduces affinity of the Cre recombinase for the arm. As a consequence, after a recombination between a lox66 and a lox71 (altered right arm sequence), one of the two resulting generated lox sites has very low recombination potential as it inherited both mutated arms. Use of lox66 & lox71 sites is potentially interresting when the recombination reaction must be "irreversible". false false _141_ 0 1568 9 In stock false No modidification was made on the lox66 sequence true Eimad Shotar BBa_I718016_sequence 1 ataacttggtatagcatacattatacgaacggta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z