BBa_I723012 1 BBa_I723012 Estimated RBS for DntR 2007-10-24T11:00:00Z 2015-08-31T04:07:53Z Cloned from a historical plasmid based on pQF52 carrying genomic sequences from ''Burkholderia cepacia''. This is the naturally-occurring RBS found in the regulatory region of the DntR gene. false false _126_ 0 2140 9 Not in stock false '''''This does not physically exist as a basic part due to time constraints; it was cloned as part of composite part which incorporates all of the components necessary for expression of a reporter gene under the control of DntR'''''. For this reason, the ends of the supplied sequence may not accurately represent the boundaries of the functional unit. false Scott Ramsay annotation1954958 1 RBS for DntR range1954958 1 1 24 BBa_I723012_sequence 1 gcaagctcttttttcagttgtctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z