BBa_I723012 1 BBa_I723012 Estimated RBS for DntR 2007-10-24T11:00:00Z 2015-08-31T04:07:53Z Cloned from a historical plasmid based on pQF52 carrying genomic sequences from ''Burkholderia cepacia''. This is the naturally-occurring RBS found in the regulatory region of the DntR gene. false false _126_ 0 2140 9 Not in stock false '''''This does not physically exist as a basic part due to time constraints; it was cloned as part of composite part which incorporates all of the components necessary for expression of a reporter gene under the control of DntR'''''. For this reason, the ends of the supplied sequence may not accurately represent the boundaries of the functional unit. false Scott Ramsay annotation1954958 1 RBS for DntR range1954958 1 1 24 BBa_I723011 1 BBa_I723011 pDntR (estimated promoter for DntR) 2007-10-24T11:00:00Z 2015-08-31T04:07:53Z Cloned from a historical plasmid based on pQF52 carrying genomic sequences from ''Burkholderia cepacia''. This is the naturally-occurring (possibly stationary-phase only) promoter for the DntR gene (which encodes the transcriptional regulator DntR) back-to-back with the DntR-regulated promoter. false false _126_ 0 2140 9 Not in stock false This does not physically exist as a basic part due to time constraints; it was cloned as part of composite part which incorporates all of the components necessary for expression of a reporter gene under the control of DntR. For this reason, the ends of the supplied sequence may not accurately represent the boundaries of the functional unit. false Scott Ramsay annotation1955001 1 pDntR range1955001 1 1 26 BBa_I723013 1 BBa_I723013 pDntA (estimated promoter for DntA) 2007-10-24T11:00:00Z 2015-08-31T04:07:53Z Cloned from a historical plasmid based on pQF52 carrying genomic sequences from ''Burkholderia cepacia''. This is the promoter activated by the transcriptional regulator DntR [BB# here] in response to detection of environmental [salicylate]. false false _126_ 0 2140 9 Not in stock false '''''This does not physically exist as a basic part due to time constraints; it was cloned as part of composite part which incorporates all of the components necessary for expression of a reporter gene under the control of DntR'''''. For this reason, the ends of the supplied sequence may not accurately represent the boundaries of the functional unit. false Scott Ramsay annotation1954960 1 pDntA range1954960 1 1 33 BBa_I723015 1 BBa_I723015 pDntA & pDntR 2007-09-25T11:00:00Z 2015-08-31T04:07:53Z Cloned from a historical plasmid based on pQF52. This is the naturally-occurring (possibly stationary-phase only) promoter for the DntR gene. false false _126_ 0 2140 9 Not in stock false false Scott Ramsay component1954981 1 BBa_I723011 component1954985 1 BBa_I723014 component1954979 1 BBa_I723012 component1954983 1 BBa_I723013 annotation1954983 1 BBa_I723013 range1954983 1 51 83 annotation1954985 1 BBa_I723014 range1954985 1 84 108 annotation1954981 1 BBa_I723011 range1954981 1 25 50 annotation1954979 1 BBa_I723012 range1954979 1 1 24 BBa_I723014 1 BBa_I723014 Estimated RBS for DntA 2007-10-24T11:00:00Z 2015-08-31T04:07:53Z Cloned from a historical plasmid based on pQF52 carrying genomic sequences from ''Burkholderia cepacia''. This is the naturally-occurring RBS found in the regulatory region of the DntA gene. false false _126_ 0 2140 9 Not in stock false '''''This does not physically exist as a basic part due to time constraints; it was cloned as part of composite part which incorporates all of the components necessary for expression of a reporter gene under the control of DntR'''''. For this reason, the ends of the supplied sequence may not accurately represent the boundaries of the functional unit. false Scott Ramsay annotation1954961 1 misc range1954961 1 1 25 BBa_I723014_sequence 1 ctgatagttaaaatcaccagcatga BBa_I723011_sequence 1 cgaatggctgcgattctagcgcgtcg BBa_I723012_sequence 1 gcaagctcttttttcagttgtctc BBa_I723013_sequence 1 atcggtatagcgctatagatcaagtctgatagt BBa_I723015_sequence 1 gcaagctcttttttcagttgtctccgaatggctgcgattctagcgcgtcgatcggtatagcgctatagatcaagtctgatagtctgatagttaaaatcaccagcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z