BBa_I723012 1 BBa_I723012 Estimated RBS for DntR 2007-10-24T11:00:00Z 2015-08-31T04:07:53Z Cloned from a historical plasmid based on pQF52 carrying genomic sequences from ''Burkholderia cepacia''. This is the naturally-occurring RBS found in the regulatory region of the DntR gene. false false _126_ 0 2140 9 Not in stock false '''''This does not physically exist as a basic part due to time constraints; it was cloned as part of composite part which incorporates all of the components necessary for expression of a reporter gene under the control of DntR'''''. For this reason, the ends of the supplied sequence may not accurately represent the boundaries of the functional unit. false Scott Ramsay annotation1954958 1 RBS for DntR range1954958 1 1 24 BBa_I723013 1 BBa_I723013 pDntA (estimated promoter for DntA) 2007-10-24T11:00:00Z 2015-08-31T04:07:53Z Cloned from a historical plasmid based on pQF52 carrying genomic sequences from ''Burkholderia cepacia''. This is the promoter activated by the transcriptional regulator DntR [BB# here] in response to detection of environmental [salicylate]. false false _126_ 0 2140 9 Not in stock false '''''This does not physically exist as a basic part due to time constraints; it was cloned as part of composite part which incorporates all of the components necessary for expression of a reporter gene under the control of DntR'''''. For this reason, the ends of the supplied sequence may not accurately represent the boundaries of the functional unit. false Scott Ramsay annotation1954960 1 pDntA range1954960 1 1 33 BBa_I723011 1 BBa_I723011 pDntR (estimated promoter for DntR) 2007-10-24T11:00:00Z 2015-08-31T04:07:53Z Cloned from a historical plasmid based on pQF52 carrying genomic sequences from ''Burkholderia cepacia''. This is the naturally-occurring (possibly stationary-phase only) promoter for the DntR gene (which encodes the transcriptional regulator DntR) back-to-back with the DntR-regulated promoter. false false _126_ 0 2140 9 Not in stock false This does not physically exist as a basic part due to time constraints; it was cloned as part of composite part which incorporates all of the components necessary for expression of a reporter gene under the control of DntR. For this reason, the ends of the supplied sequence may not accurately represent the boundaries of the functional unit. false Scott Ramsay annotation1955001 1 pDntR range1955001 1 1 26 BBa_I723014 1 BBa_I723014 Estimated RBS for DntA 2007-10-24T11:00:00Z 2015-08-31T04:07:53Z Cloned from a historical plasmid based on pQF52 carrying genomic sequences from ''Burkholderia cepacia''. This is the naturally-occurring RBS found in the regulatory region of the DntA gene. false false _126_ 0 2140 9 Not in stock false '''''This does not physically exist as a basic part due to time constraints; it was cloned as part of composite part which incorporates all of the components necessary for expression of a reporter gene under the control of DntR'''''. For this reason, the ends of the supplied sequence may not accurately represent the boundaries of the functional unit. false Scott Ramsay annotation1954961 1 misc range1954961 1 1 25 BBa_I723016 1 BBa_I723016 DntR transcriptional regulator 2007-10-24T11:00:00Z 2015-08-31T04:07:53Z Cloned from a historical plasmid based on pQF52 carrying genomic sequences from ''Burkholderia cepacia''. Contains the DntR gene (encodes a transcriptional regulator activated by [salicylate]) under the control of its native promoter. To complete the system, clone the gene you want to induce under the control of promoter pDntA [insert BB # here later]. false false _126_ 0 2140 9 Not in stock false '''''The precise boundaries of the promoters and ribosome binding sites are unknown, however they are known to exist back-to-back and were consequently cloned as one entire physical unit.''''' false Scott Ramsay component1955008 1 BBa_I723012 component1955010 1 BBa_I723011 component1955004 1 BBa_B0025 component1955012 1 BBa_I723013 component1955014 1 BBa_I723014 component1955006 1 BBa_I723010 annotation1955014 1 BBa_I723014 range1955014 1 1119 1143 annotation1955004 1 BBa_B0025 range1955004 1 1 129 annotation1955012 1 BBa_I723013 range1955012 1 1086 1118 annotation1955006 1 BBa_I723010 range1955006 1 130 1035 annotation1955010 1 BBa_I723011 range1955010 1 1060 1085 annotation1955008 1 BBa_I723012 range1955008 1 1036 1059 BBa_B0025 1 BBa_B0025 double terminator (B0015), reversed 2003-12-02T12:00:00Z 2015-08-31T04:07:20Z -- No description -- false true _1_ 0 24 7 In stock false true Caitlin Conboy annotation369702 1 B0012 range369702 1 1 41 annotation369703 1 B0010 range369703 1 50 129 BBa_I723010 1 DntR DntR coding region 2007-09-05T11:00:00Z 2015-08-31T04:07:53Z Cloned from [IL DntR in pQF52]. The protein encoded by DntR recognises environmental [salicylate] and undergoes a conformational change allowing it to, and positively regulate, the promoter for the gene DntA. DntR, therefore, should be used in combination with pDntA to acheive a switch that responds to [salicylate]. false false _126_ 0 2140 9 Not in stock false This transcriptional regulator is encoded in the opposite direction to that of its target promoter. false Scott Ramsay annotation1954937 1 DntR range1954937 1 1 906 BBa_I723014_sequence 1 ctgatagttaaaatcaccagcatga BBa_I723011_sequence 1 cgaatggctgcgattctagcgcgtcg BBa_I723012_sequence 1 gcaagctcttttttcagttgtctc BBa_I723013_sequence 1 atcggtatagcgctatagatcaagtctgatagt BBa_I723010_sequence 1 aatacgaagtctcttttcgagctgcttgttgactgcatcggtgtacaacgggcctagggccaacatgaaccgtacggttttgtccaactaccgctacagtccgtcgaaccggcccacgcccctacagcagtctggttttccgtgaagcgtcgcttgccgttttgcgacgccgtgccagcgctactccagccacgacacgtcttaccccggctagcgttactttacgccgtggtggtcggcgtacgcggaaaactacggacgcgcaagctcgtccggtagctggagtggcacaggccacaactcacgctggtgcggctgtacgaggtcaagtcacttgacaaagtccgagtaccccctaaaccgcgaacctaccaggaacgccttgtacgtatgcatcgccaccgctttctccgcggcgaccttcttaggccagacatcgagaccgtcttctgggttccgctctagttggcgtggcctgaggtataggaggaagtctaacggtcgtaagcccgcgtcgcacgactagacctacactcctcgagcaacgcgttcgcgaaggtagtcacccccgtacttcatgtagagcggctacagccagtaacggttcaacttccacgcgcacgaccgtttacccagctttctcagtgcccagcagtcacggcagacgtcgcacaactcgcgtatctagtgcccgaggcgttctacgtcacgtatgccacagccgaggtacggaaaactccacgcgttcttgtttagcagcaagtcgcgacatgcgtcggcaaattcacttaatgactgccgtccgacgcagtcggggtcaaaaagcggccggcagctatgcgaggccagctcgtcatcgaccaacttctggtggtcgtctaagttcagctacagcgcgtctaggta BBa_I723016_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggaatacgaagtctcttttcgagctgcttgttgactgcatcggtgtacaacgggcctagggccaacatgaaccgtacggttttgtccaactaccgctacagtccgtcgaaccggcccacgcccctacagcagtctggttttccgtgaagcgtcgcttgccgttttgcgacgccgtgccagcgctactccagccacgacacgtcttaccccggctagcgttactttacgccgtggtggtcggcgtacgcggaaaactacggacgcgcaagctcgtccggtagctggagtggcacaggccacaactcacgctggtgcggctgtacgaggtcaagtcacttgacaaagtccgagtaccccctaaaccgcgaacctaccaggaacgccttgtacgtatgcatcgccaccgctttctccgcggcgaccttcttaggccagacatcgagaccgtcttctgggttccgctctagttggcgtggcctgaggtataggaggaagtctaacggtcgtaagcccgcgtcgcacgactagacctacactcctcgagcaacgcgttcgcgaaggtagtcacccccgtacttcatgtagagcggctacagccagtaacggttcaacttccacgcgcacgaccgtttacccagctttctcagtgcccagcagtcacggcagacgtcgcacaactcgcgtatctagtgcccgaggcgttctacgtcacgtatgccacagccgaggtacggaaaactccacgcgttcttgtttagcagcaagtcgcgacatgcgtcggcaaattcacttaatgactgccgtccgacgcagtcggggtcaaaaagcggccggcagctatgcgaggccagctcgtcatcgaccaacttctggtggtcgtctaagttcagctacagcgcgtctaggtagcaagctcttttttcagttgtctccgaatggctgcgattctagcgcgtcgatcggtatagcgctatagatcaagtctgatagtctgatagttaaaatcaccagcatga BBa_B0025_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z