BBa_I723019 1 BBa_I723019 RBS for XylR 2007-10-24T11:00:00Z 2015-08-31T04:07:54Z [Christine/Maia] This is the naturally-occurring RBS found in the regulatory region of the DntR gene. gataaaaacaagaggaaaacaa false false _126_ 0 2140 9 Not in stock false [Chistine/Maia] false Scott Ramsay annotation1955263 1 RBS range1955263 1 1 20 BBa_I723019_sequence 1 taaaaacaagaggaaaacaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z