BBa_I723149 1 BBa_I723149 DmpR_SDM_PstI_1_for 2007-10-24T11:00:00Z 2015-08-31T04:07:54Z Shingler, V., Bartilson, M., Moore, T. 1993 Cloning and Nucleotide Sequence of the Gene Encoding the Positive Regulator (DmpR) of the Phenol Catabolic Pathway Encoded by pVI150 and Identification of DmpR as a Member of the NtrC Family of Transcriptional Activators Journal of Bacteriology 175:1596-1604 PMID: 8449869 Shingler, V., Moore, T. 1994 Sensing of aromatic compounds by the DmpR transcriptional activator of phenol-catabolizing Pseudomonas sp. strain CF600 Jounal of Bacteriology 176(6):1555-60 PMID: 8132448 Forward primer for site directed mutagenesis of PstI Site 1 in DmpR. true false _126_ 0 2139 9 Discontinued false false Christine Merrick BBa_I723149_sequence 1 ctggagcaacagcatgcgctgttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z