BBa_I728004 1 BBa_I728004 CPX with polystyrene-binding peptide 2007-06-20T11:00:00Z 2015-08-31T04:07:55Z Comes from Ompx protein. CPX expresses the polystyrene binding peptide on the outside of the E.Coli cell. We have added in a His tag, a trypsin cleavage site and we have flanked this sequence with Ecor1 and Xba1 cut sites. false false _138_ 0 1371 102 Not in stock false None. false aditya kohli annotation1935085 1 His Tag range1935085 1 91 108 annotation1935082 1 EcoR1 range1935082 1 628 633 annotation1935087 1 Polystyrene Binding Peptide range1935087 1 115 153 annotation1935090 1 N-C Terminus Linker range1935090 1 457 468 annotation1935084 1 Linker w/ sfi1 cut site range1935084 1 76 90 annotation1935086 1 Trypsin Cleavage range1935086 1 109 114 annotation1935083 1 Native Signal Sequence range1935083 1 7 75 annotation1935091 1 A1-S53 range1935091 1 469 627 annotation1935081 1 xBa1 range1935081 1 1 6 annotation1935088 1 Linker w/sfi cut site range1935088 1 154 171 annotation1935089 1 S54-F148 range1935089 1 172 456 BBa_I728004_sequence 1 tctagaatgaaaaaaattgcatgtctttcagcactggccgcagttctggctttcaccgcaggtacttccgtagctggccagtctggccagcaccaccaccaccaccacaaacgtttcttctctttcttcttcccggcttctgcttggggttctggtggccagtctggccagtctggtgactacaacaaaaaccagtactacggcatcactgctggtccggcttaccgcattaacgactgggcaagcatctacggtgtagtgggtgtgggttatggtaaattccagaccactgaatacccgacctacaaacacgacaccagcgactacggtttctcctacggtgcgggtctgcagttcaacccgatggaaaacgttgctctggacttctcttacgagcagagccgtattcgtagcgttgacgtaggcacctggattgccggtgttggttaccgcttcggtggttctggtgcgacttctactgtaactggcggttacgcacagagcgacgctcagggccaaatgaacaaaatgggcggtttcaacctgaaataccgctatgaagaagacaacagcccgctgggtgtgatcggttctttcacttacaccgagaaaagccgtactgcaagcgaattc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z