BBa_I728456 1 BBa_I728456 MerRT: Mercury-Inducible Promoter+RBS (MerR + part of MerT) 2007-10-22T11:00:00Z 2015-08-31T04:07:55Z This part was PCR'ed off of plasmid pT040 from the paper "Metalloregulatory DNA-Binding Protein Encoded by the merR Gene: Isolation and Characterization" by Thomas O'Halloran and Christopher Walsh. The plasmid pT040 contains part of Tn501, Genbank accession: Z00027. This part is taken from the Mer operon on Tn501 and includes MerR, a mercury-inducible promoter, its Shine-Delgarno sequence, and the first few amino acids of MerT. MerR is a protein that binds to the Mer operon and undergoes a conformational change in the presence of Hg(II) ions which allows RNA polymerase to transcribe MerT and other proteins further downstream. false false _138_ 0 1555 167 It's complicated false The MerR protein sequence is transcribed in the reverse direction from the rest of the operon. false Bernice Huang annotation1975682 1 MerT (first part) range1975682 1 561 628 annotation1975681 1 -35 and -10 hexamers range1975681 1 480 560 annotation1975680 1 MerR range1975680 1 54 479 BBa_I728456_sequence 1 ctctttgaccaggctttctaaggggtcgtctcagaaaacggaaaataaagcacgctaaggcatagccgaacctgccaagcttgctccaccctgtagtgacgcgatcagcgggcaggaaacgttcccccttcgcgcatggcaggcgcacaccaactcagacagcacggcctccatgcgcgccaggtcagccattttctcgcgcacgtccttgagcttgtgctcggccagactgctggcttcctcgcaatgggtgccatcctccagccgcagcagctcggcgatctcatccaggctgaagcccagccgctgggctgatttcacgaagcgcacccgcgttacatccgcctcgccatagcggcggatgctgccatagggcttgtcaggctccagcaacaagcccttgcgctgatagaaacggatggtctccacattgaccccggccgccttggcgaaaacgccaatggtcaggttctccaaattgttttccatatcgcttgactccgtacatgagtacggaagtaaggttacgctatccaatttcaattcgaaaggacaagcgcatgtctgaaccaaaaaccgggcgcggcgcgctcttcactggagggcttgccgctatccttgcttctgcttgttag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z