BBa_I728500 1 CPX CPX Terminal Surface Display Protein with Polystyrene-Binding Peptide 2007-07-30T11:00:00Z 2015-08-31T04:07:55Z Rice JJ, Schohn A, Bessette PH, Boulware KT, and Daugherty PS. Bacterial display using circularly permuted outer membrane protein OmpX yields high affinity peptide ligands. Protein Sci 2006 Apr; 15(4) 825-36. doi:10.1110/ps.051897806 pmid:16600968 This will be filled in later. false false _138_ 0 1695 9 It's complicated false Max of XXXX amino acid long peptide. true Toan Tran-Phu annotation1940502 1 SfiI Restriction Site range1940502 1 70 84 annotation1940506 1 Linker range1940506 1 478 489 annotation1940505 1 S54-F148 of OmpX range1940505 1 193 477 annotation1940504 1 Linker range1940504 1 175 192 annotation1940510 1 T7 Antibody Tag range1940510 1 142 174 annotation1940501 1 Native Starting Signal range1940501 1 1 69 annotation1975607 1 Coding sequence range1975607 1 1 654 annotation1940508 1 Double stop codon (TGATAA) range1940508 1 649 654 annotation1940500 1 Start codon range1940500 1 1 3 annotation1940511 1 SalI Restriction Site range1940511 1 130 135 annotation1940503 1 Polystyrene Sticky Peptide range1940503 1 91 129 annotation1940512 1 Trypsin Cleavage Site range1940512 1 136 141 annotation1940509 1 BglII Cut Site range1940509 1 85 90 annotation1940507 1 A1-S53 of OmpX range1940507 1 490 648 BBa_I728500_sequence 1 atgaaaaaaattgcgtgcctgagcgcgctggccgcggttctggcctttaccgcgggcaccagcgttgcgggccagtctggccaaagatcttttttcagctttttttttccggcgagcgcgtggggtagcgtcgacaaacgtatggcgagcatgaccggcggtcagcagatgggtggtggccagagcggccagagcggtgattataacaaaaaccagtattatggcattaccgcgggtccggcgtatcgtattaacgattgggcgagcatttatggcgtggtgggcgtgggctatggcaaatttcagaccaccgaatatccgacctataaacacgataccagcgattatggctttagctatggcgcgggtctgcaatttaatccgatggaaaacgtggcgctggattttagctatgaacagagccgtattcgtagcgtggatgtgggcacctggattgcgggcgtgggttatcgttttggcggcagcggtgcgaccagcaccgtgaccggcggttatgcgcagagcgatgcgcagggccagatgaacaaaatgggcggcttcaacctgaaatatcgctatgaagaagataacagcccgctgggcgtgattggcagctttacctataccgaaaaaagccgtaccgcgagctgataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z