BBa_I728951 1 BBa_I728951 Human Matrix Metalloproteinase 1 (Mmp1) 2008-04-29T11:00:00Z 2015-08-31T04:07:55Z From human origin This is the gene for the Human Matrix Metallopeptidase 1 (interstitial collagenase). Proteins in the metalloproteinase family are involved in breaking down the extracellular matrix in physiological processes. This gene encodes for an active interstitial collagenase that breaks down interstitial type I, II, and III collagen. For our project, this gene is intended to be expressed in E.Coli for the purposes of breaking down formed scar tissue in the heart. The collagenase secretion will be regulated to prevent over-secretion and damage to adjacent cells. false false _138_ 0 1371 102 Not in stock false We had to change nucleotide 710 from a C to a T in order to get rid of a PstI site. I also added an ATG codon to the beginning of the sequence because this sequence is the active, cleaved form of Mmp1 and it doesn't have a start codon in it. false aditya kohli BBa_I728951_sequence 1 gaattcgcggccgcttctagatgcctagctacaccttcagtggtgatgttcagctagctcaggatgacattgatggcatccaagccatatatggacgttcccaaaatcctgtccagcccatcggcccacaaaccccaaaagcgtgtgacagtaagctaacctttgatgctataactacgattcggggagaagtgatgttctttaaagacagattctacatgcgcacaaatcccttctacccggaagttgagctcaatttcatttctgttttctggccacaactgccaaatgggcttgaagctgcttacgaatttgccgacagagatgaagtccggtttttcaaagggaataagtactgggctgttcagggacagaatgtgctacacggataccccaaggacatctacagctcctttggcttccctagaactgtgaagcatatcgatgctgctctttctgaggaaaacactggaaaaacctacttctttgttgctaacaaatactggaggtatgatgaatataaacgatctatggatccaggttatcccaaaatgatagcacatgactttcctggaattggccacaaagttgatgcagttttcatgaaagatggatttttctatttctttcatggaacaagacaatacaaatttgatcctaaaacgaagagaattttgactctccagaaagctaatagctggttcaactgtaggaaaaattgatactagtagcggccgctgcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z