BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I732007 1 Adapter BglII + BamHI 2007-07-06T11:00:00Z 2015-08-31T04:07:56Z [[http://openwetware.org/wiki/Silver:_Oligonucleotide_Inserts Oligonucleotide Inserts]] Released HQ 2013 BglII and BamHI restriction sites with some flanking false false _156_ 0 1557 9 In stock false None true Zhan Jian annotation1936907 1 BglII range1936907 1 3 8 annotation1936908 1 BamHI range1936908 1 12 17 BBa_I732006 1 lacZ-alpha lacZ alpha fragment 2007-07-06T11:00:00Z 2015-08-31T04:07:56Z PCR amplified from BBa_J33202 without the RBS. Released HQ 2013 In strains with lacZ-omega (lacZ N-terminal deletion mutant) like DH5alpha, DH10B and Top10, lacZ-alpha restores the beta-galactosidase activity. false true _156_ 0 1557 9 In stock false None true Zhan Jian annotation1936904 1 lacZ range1936904 1 1 234 annotation1936906 1 STOP range1936906 1 229 234 annotation1936905 1 START range1936905 1 1 3 BBa_I732074 1 BBa_I732074 Promoter Adaptor + LacZ-alpha Reporter 2007-08-01T11:00:00Z 2015-08-31T04:07:57Z N/A Released HQ 2013 N/A false false _156_ 0 1557 9 In stock false N/A false Zhan Jian component1940654 1 BBa_I732007 component1940660 1 BBa_I732006 component1940656 1 BBa_B0034 annotation1940660 1 BBa_I732006 range1940660 1 46 279 annotation1940654 1 BBa_I732007 range1940654 1 1 19 annotation1940656 1 BBa_B0034 range1940656 1 28 39 BBa_B0034_sequence 1 aaagaggagaaa BBa_I732074_sequence 1 gaagatcttccggatccggtactagagaaagaggagaaatactagatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtaataa BBa_I732006_sequence 1 atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtaataa BBa_I732007_sequence 1 gaagatcttccggatccgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z