BBa_I732094 1 BBa_I732094 Promoter Activity Reporter (LacZ-alpha and GFP-AAV) 2007-09-19T11:00:00Z 2015-08-31T04:07:57Z To be later edited. Released HQ 2013 To be later edited. false false _156_ 0 1572 9 In stock false To be later edited. true Zhan Jian component1944363 1 BBa_B0012 component1944359 1 BBa_B0034 component1944361 1 BBa_B0010 component1944351 1 BBa_I732007 component1944360 1 BBa_E0044 component1944357 1 BBa_I732006 component1944353 1 BBa_B0034 annotation1944363 1 BBa_B0012 range1944363 1 1161 1201 annotation1944361 1 BBa_B0010 range1944361 1 1073 1152 annotation1944357 1 BBa_I732006 range1944357 1 46 279 annotation1944351 1 BBa_I732007 range1944351 1 1 19 annotation1944360 1 BBa_E0044 range1944360 1 306 1064 annotation1944353 1 BBa_B0034 range1944353 1 28 39 annotation1944359 1 BBa_B0034 range1944359 1 288 299 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_E0044 1 BBa_E0044 green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212) 2004-09-29T11:00:00Z 2015-08-31T04:07:25Z Released HQ 2013 GFP-AAV [Pst1 site in earlier version knocked out] false false _11_1_ 0 61 7 In stock false true jcbraff BBa_I732006 1 lacZ-alpha lacZ alpha fragment 2007-07-06T11:00:00Z 2015-08-31T04:07:56Z PCR amplified from BBa_J33202 without the RBS. Released HQ 2013 In strains with lacZ-omega (lacZ N-terminal deletion mutant) like DH5alpha, DH10B and Top10, lacZ-alpha restores the beta-galactosidase activity. false true _156_ 0 1557 9 In stock false None true Zhan Jian annotation1936905 1 START range1936905 1 1 3 annotation1936904 1 lacZ range1936904 1 1 234 annotation1936906 1 STOP range1936906 1 229 234 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_I732007 1 Adapter BglII + BamHI 2007-07-06T11:00:00Z 2015-08-31T04:07:56Z [[http://openwetware.org/wiki/Silver:_Oligonucleotide_Inserts Oligonucleotide Inserts]] Released HQ 2013 BglII and BamHI restriction sites with some flanking false false _156_ 0 1557 9 In stock false None true Zhan Jian annotation1936908 1 BamHI range1936908 1 12 17 annotation1936907 1 BglII range1936907 1 3 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I732094_sequence 1 gaagatcttccggatccggtactagagaaagaggagaaatactagatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtaataatactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaaaggcctgctgcaaacgacgaaaactacgctgctgctgtttaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I732006_sequence 1 atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtaataa BBa_I732007_sequence 1 gaagatcttccggatccgg BBa_E0044_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaaaggcctgctgcaaacgacgaaaactacgctgctgctgtttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z