BBa_I732400 1 U097NUL+D0 Promoter Family Member (U097NUL+D062NUL) 2007-10-03T11:00:00Z 2015-08-31T04:07:58Z None. P_template1 serves as the truss for PCR cloning. By respectively applying 7 different primers upstream and downstream, that is, 49 pairs of primers in total, we have got 49 different promoters. Then we made them digsted and loaded into a vector that has already possessed a lacZ-alpha fragment. In this way, we can read from the color of the clones on the plate whether the inserted promoter works or not. By this means, We can try seven different positions for Operator A and seven for Operator B, thus constructing 7*7 kinds of promoters which have actually constituted a specific promoter family. After transformed into the four test plasmids (pCR00, pCR01, pCR10, pCR11) together with a downstream double-reporter system, we will get to know the solo-repression and co-repression effects of the two repressors on the specific promoter. false false _156_ 0 1572 9 Not in stock false None. false Zhan Jian BBa_I732400_sequence 1 tacccacaacccaattcgagaccggaactcgattgtatctgtagtgctttagtagtggagtttacactttatgcttccggctcgtataatgtgtggaacatcccctttatctatcgcctgtgcccactacatcaagccaaattaaacaggattaacaggatccgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z