BBa_I733001 1 BBa_I733001 big toe 2007-06-06T11:00:00Z 2015-08-31T04:08:00Z kirill code for gene leading to big toe itis true false _152_ 0 285 82 Discontinued false low mental development false Stephen Davies BBa_I733002 1 BBa_I733002 big toe meter 2007-06-06T11:00:00Z 2015-08-31T04:08:00Z conrad big foot inch true false _152_ 0 285 82 Discontinued false shorts false Stephen Davies component1934260 1 BBa_I733001 component1934259 1 BBa_I733000 annotation1934260 1 BBa_I733001 range1934260 1 17 28 annotation1934259 1 BBa_I733000 range1934259 1 1 8 BBa_I733000 1 BBa_I733000 pretend meter 2007-06-06T11:00:00Z 2015-08-31T04:08:00Z brain long meter true false _152_ 0 285 82 Discontinued false trivial false Stephen Davies BBa_I733000_sequence 1 acacacac BBa_I733001_sequence 1 ttttttaaaaat BBa_I733002_sequence 1 acacacactactagagttttttaaaaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z