BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_I737005 1 BBa_I737005 AHL and RNA lock controlled AraC 2007-06-03T11:00:00Z 2015-08-31T04:08:01Z All parts from the registry, except for the RNA lock which was synthesized based on the sequence from the registry for that part. AraC coding region, under control of an AHL inducible promoter and an RNA locked RBS. false false _114_ 0 1800 9 Not in stock false The purpose of this part is to serve as a control on light detection by an outside signal (AHL), so that the rest of the system can't be activated by the light until we apply AHL. false Patrick King component2252675 1 BBa_C0080 component2252666 1 BBa_R0062 component2252682 1 BBa_B0015 component2252671 1 BBa_J23031 annotation2252671 1 BBa_J23031 range2252671 1 64 105 annotation2252682 1 BBa_B0015 range2252682 1 1060 1188 annotation2252675 1 BBa_C0080 range2252675 1 112 1051 annotation2252666 1 BBa_R0062 range2252666 1 1 55 BBa_J23031 1 BBa_J23031 [lock3c] 2006-08-02T11:00:00Z 2015-08-31T04:08:39Z Extension of overlapping oligonucleotides key3c false false _52_ 0 483 95 In stock false N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_C0080 1 araC araC arabinose operon regulatory protein (repressor/activator) from E. coli (+LVA) 2004-01-27T12:00:00Z 2015-08-31T04:07:24Z GenBank: NC_002655 (www.ncbi.nlm.nih.gov) Released HQ 2013 coding region for the araC gene, used to make araC protein for use in positive or negative regulation of TIPs output (see also R0080, R0081) false false _1_ 0 24 7 In stock false true Sara Neves (Fighting Darwins) annotation308196 1 LVA range308196 1 877 909 annotation308191 1 araC range308191 1 1 876 annotation2214004 1 Help:Barcodes range2214004 1 916 940 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_R0062 1 lux pR Promoter (luxR & HSL regulated -- lux pR) 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <em>V. fischeri</em> Released HQ 2013 Promoter activated by LuxR in concert with HSL</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the LuxR activator protein complexed with the autoinducer, 3-oxo-hexanoyl-HSL. Two molecules of LuxR protein form a complex with two molecules of the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription. false true _1_ 0 24 7 In stock false <P> <P>This promoter is based on the <em>Vibrio fischeri </em>quorum sensing gene promoters. Two genes LuxI and LuxR and transcribed in opposite directions as shown below. The original sequence from which the parts <bb_part>BBa_R0062</bb_part> and <bb_part>BBa_R0063</bb_part> were derived is shown in the picture below. <p><img src="<bb_file>Image1.gif</bb_file>" width="614" height="362"><P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation7070 1 BBa_R0062 range7070 1 1 55 annotation2048 1 start range2048 1 53 53 annotation2047 1 -10 range2047 1 42 47 annotation2046 1 -35 range2046 1 20 25 annotation2045 1 LuxR/HSL range2045 1 1 20 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I737005_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactagagaactagaatcacctcttgcttttgggtaagacgaagaggagatactagatggctgaagcgcaaaatgatcccctgctgccgggatactcgtttaacgcccatctggtggcgggtttaacgccgattgaggccaatggttatctcgatttttttatcgaccgaccgctgggaatgaaaggttatattctcaatctcaccattcgcggtcagggggtggtgaaaaatcagggacgagaatttgtctgccgaccgggtgatattttgctgttcccgccaggagagattcatcactacggtcgtcatccggaggctcgcgaatggtatcaccagtgggtttactttcgtccgcgcgcctactggcatgaatggcttaactggccgtcaatatttgccaatacgggtttctttcgcccggatgaagcgcaccagccgcatttcagcgacctgtttgggcaaatcattaacgccgggcaaggggaagggcgctattcggagctgctggcgataaatctgcttgagcaattgttactgcggcgcatggaagcgattaacgagtcgctccatccaccgatggataatcgggtacgcgaggcttgtcagtacatcagcgatcacctggcagacagcaattttgatatcgccagcgtcgcacagcatgtttgcctgtcgccgtcgcgtctgtcacatcttttccgccagcagttagggattagcgtcttaagctggcgcgaggaccaacgcatcagccaggcgaagctgcttttgagcactacccggatgcctatcgccaccgtcggtcgcaatgttggttttgacgatcaactctatttctcgcgagtatttaaaaaatgcaccggggccagcccgagcgagttccgtgccggttgtgaagaaaaagtgaatgatgtagccgtcaagttgtcagctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0062_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_C0080_sequence 1 atggctgaagcgcaaaatgatcccctgctgccgggatactcgtttaacgcccatctggtggcgggtttaacgccgattgaggccaatggttatctcgatttttttatcgaccgaccgctgggaatgaaaggttatattctcaatctcaccattcgcggtcagggggtggtgaaaaatcagggacgagaatttgtctgccgaccgggtgatattttgctgttcccgccaggagagattcatcactacggtcgtcatccggaggctcgcgaatggtatcaccagtgggtttactttcgtccgcgcgcctactggcatgaatggcttaactggccgtcaatatttgccaatacgggtttctttcgcccggatgaagcgcaccagccgcatttcagcgacctgtttgggcaaatcattaacgccgggcaaggggaagggcgctattcggagctgctggcgataaatctgcttgagcaattgttactgcggcgcatggaagcgattaacgagtcgctccatccaccgatggataatcgggtacgcgaggcttgtcagtacatcagcgatcacctggcagacagcaattttgatatcgccagcgtcgcacagcatgtttgcctgtcgccgtcgcgtctgtcacatcttttccgccagcagttagggattagcgtcttaagctggcgcgaggaccaacgcatcagccaggcgaagctgcttttgagcactacccggatgcctatcgccaccgtcggtcgcaatgttggttttgacgatcaactctatttctcgcgagtatttaaaaaatgcaccggggccagcccgagcgagttccgtgccggttgtgaagaaaaagtgaatgatgtagccgtcaagttgtcagctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23031_sequence 1 aactagaatcacctcttgcttttgggtaagacgaagaggaga BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z