BBa_I739101 1 BBa_I739101 Double Promoter (constitutive / TetR, negative) 2007-10-11T11:00:00Z 2015-08-31T04:08:01Z Synthetic DNA sdfasdf false false _124_ 0 2183 62 Not in stock false asdf false Stefan Luzi annotation1946099 1 Scar range1946099 1 36 43 annotation1946100 1 J23100 range1946100 1 1 35 annotation1946257 1 R0040 (2x TetR 1) range1946257 1 44 83 annotation1946102 1 TetR 1 range1946102 1 44 63 annotation1946101 1 TetR 1 range1946101 1 64 83 BBa_I739101_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagtccctatcagtgatagagattccctatcagtgatagagat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z