BBa_I739102 1 BBa_I739102 Double Promoter (cI, negative / TetR, negative) 2007-10-13T11:00:00Z 2015-08-31T04:08:01Z Synthetic DNA asdf false false _124_ 0 2183 62 Not in stock false asdf false Stefan Luzi annotation1946932 1 TetR 1 range1946932 1 78 97 annotation1946934 1 TetR 1 range1946934 1 58 77 annotation1946933 1 R0040 (2x TetR 1) range1946933 1 58 97 annotation1946930 1 R0051 range1946930 1 1 49 annotation1946931 1 Scar range1946931 1 50 57 BBa_I739102_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagtccctatcagtgatagagattccctatcagtgatagagat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z