BBa_I739104 1 BBa_I739104 Double Promoter (LuxR/HSL, positive / P22 cII, negative) 2007-10-14T11:00:00Z 2015-08-31T04:08:01Z Synthetic DNA asdf false false _124_ 0 2183 62 Not in stock false asdf false Stefan Luzi annotation1947892 1 Scar range1947892 1 56 63 annotation1947894 1 OR1 range1947894 1 83 101 annotation1947895 1 R0053 (2x OR1) range1947895 1 64 101 annotation1947891 1 R0062 range1947891 1 1 55 annotation1947893 1 OR1 range1947893 1 64 82 BBa_I739104_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactagagatttaagtgttctttaattatttaagtgttctttaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z