BBa_I739106 1 BBa_I739106 Double Promoter (TetR, negative / P22 cII, negative) 2007-10-15T11:00:00Z 2015-08-31T04:08:01Z Synthetic DNA asdf false false _124_ 0 2183 62 Not in stock false asdf false Stefan Luzi annotation1947941 1 R0053 (2x OR1) range1947941 1 49 84 annotation1947939 1 OR1 range1947939 1 49 66 annotation1947940 1 OR1 range1947940 1 67 84 annotation1947938 1 R0040 range1947938 1 1 48 BBa_I739106_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactatttaagtgttctttaatatttaagtgttctttaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z