BBa_I741004 1 BBa_I741004 XylR transcriptional regulator 2007-06-06T11:00:00Z 2015-08-31T04:08:01Z From chromosomal DNA Regulates based on the presence of xylose. true false _143_ 0 1660 9 Discontinued false none false Noah Johnson BBa_I741004_sequence 1 actgtactgtactgtactattatttggcaatactg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z