BBa_I741109 1 BBa_I741109 Lambda Or operator region 2007-07-05T11:00:00Z 2015-08-31T04:08:02Z Lambda genome from NCBI Released HQ 2013 This is the unmodified version of the lambda operator (Or) that is controlled by Cro and Cl concentrations. false true _143_ 0 1939 9 In stock false none false Galen Lynch annotation1936877 1 -35 region range1936877 1 48 53 annotation1936878 1 Cro, Cl binding regio (Or1) range1936878 1 58 74 annotation1936873 1 -10 region range1936873 1 7 12 annotation1936874 1 Cro, Cl binding region (Or3) range1936874 1 11 27 annotation1936875 1 -35 region range1936875 1 30 35 annotation1936879 1 -10 region range1936879 1 71 76 annotation1936876 1 Cro, Cl binding region (Or2) range1936876 1 34 50 BBa_I741109_sequence 1 acgttaaatctatcaccgcaagggataaatatctaacaccgtgcgtgttgactattttacctctggcggtgataatggttgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z