BBa_I741111 1 BBa_I741111 Lambda Antirepressor Cro 2007-07-05T11:00:00Z 2015-08-31T04:08:02Z Lambda genome from NCBI Released HQ 2013 This protein is the antirepressor (cro) in bacteriopage lambda. It binds to OR and OL in the natural lambda genome. false true _143_ 0 1939 9 In stock false Open reading frame false Galen Lynch annotation1936884 1 Start Codon range1936884 1 1 3 annotation1936883 1 Cro Antirepressor range1936883 1 1 201 annotation1936885 1 Stop Codon range1936885 1 199 201 BBa_I741111_sequence 1 atggaacaacgcataaccctgaaagattatgcaatgcgctttgggcaaaccaagacagctaaagatctcggcgtatatcaaagcgcgatcaacaaggccattcatgcaggccgaaagatttttttaactataaacgctgatggaagcgtttatgcggaagaggtaaagcccttcccgagtaacaaaaaaacaacagcataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z