BBa_I742101 1 difF dif site with forward orientation 2007-08-07T11:00:00Z 2015-08-31T04:08:02Z E. coli K12 Released HQ 2013 'dif' (division induced filamentation) is the recombination site for XerC and XerD recombinases. Once replicated, aligned direct repeats of the dif site are vital to DNA monomerisation during bacterial septation. As with other recombinase sites, inverted repeats cause inversion of the DNA in between. However, XerCD requires activation by FtsK and thus two dif-sites (see also part BBa_I742102) enables recombination that is temporally isolated to septation. false false _123_ 0 1965 9 In stock true Constructed as two complimentary oligonucleotides. true Xiaonan Wang annotation1955264 1 dif site (forward) range1955264 1 4 31 annotation1940992 1 SacI range1940992 1 1 3 BBa_I742101_sequence 1 ctcggtgcgcataatgtatattatgttaaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z