BBa_I742102 1 difR dif site with reverse orientation 2007-08-07T11:00:00Z 2015-08-31T04:08:02Z E. coli K12 Released HQ 2013 'dif' (division induced filamentation) is the recombination site for XerC and XerD recombinases. Once replicated, aligned direct dif repeats are vital to DNA monomerisation during bacterial septation. As with other recombination sites, inverted repeats cause inversion of the DNA in between. However, XerCD requires activation by FtsK and thus two dif-sites (see also part BBa_I742102) enable recombination that is temporally isolated to division. false false _123_ 0 1965 9 In stock true Synthesised using two oligonucleotides. true Xiaonan Wang annotation1955265 1 dif site (reverse) range1955265 1 4 31 annotation1940993 1 SacI range1940993 1 1 3 BBa_I742102_sequence 1 ctcatttaacataatatacattatgcgcacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z