BBa_I742109 1 rbs+COMT COMT gene with ribosome binding site 2007-10-18T11:00:00Z 2015-08-31T04:08:02Z Genes and Enzymes Involved in Caffeic Acid Biosynthesis in the Actinomycete Saccharothrix esanaensis, Berner M, et al, Journal of Bacteriology 188(7): 2666, (2006) Gowri G, et al, Molecular cloning and expression of alfalfa S-adenosyl-L-methionine: caffeic acid 3-0-methyltransferase, a key enzyme of lignin biosynthesis, Plant Physiology 97(1):7 (1991) Downregulation of Caffeic Acid 3-O-Methyltransferase and Caffeoyl CoA 3-O-Methyltransferase in Transgenic Alfalfa Impacts on Lignin Structure and Implications for the Biosynthesis of G and S Lignin, Guo D, et al, Plant Cell. January; 13(1): 73 (2001) Released HQ 2013 COMT (caffeic acid-O-methyl transferase) with ribosome binding site. Enzyme methylates -OH on C4 of the caffeic acid aromatic ring to produce ferulic acid. COMT is the third gene in the vanillin biosynthesis pathway, false false _123_ 0 1964 9 In stock true Used COMT cDNA as genomic DNA contains introns true sarah hollingshead component1949770 1 BBa_J15001 component1949771 1 BBa_I742107 annotation1949770 1 BBa_J15001 range1949770 1 1 10 annotation1949771 1 BBa_I742107 range1949771 1 17 1117 BBa_I742107 1 COMT COMT 2007-10-18T11:00:00Z 2015-08-31T04:08:02Z Alfalfa cDNA Genes and Enzymes Involved in Caffeic Acid Biosynthesis in the Actinomycete Saccharothrix esanaensis, Berner M, et al, Journal of Bacteriology 188(7): 2666, (2006) Gowri G, et al, Molecular cloning and expression of alfalfa S-adenosyl-L-methionine: caffeic acid 3-0-methyltransferase, a key enzyme of lignin biosynthesis, Plant Physiology 97(1):7 (1991) Downregulation of Caffeic Acid 3-O-Methyltransferase and Caffeoyl CoA 3-O-Methyltransferase in Transgenic Alfalfa Impacts on Lignin Structure and Implications for the Biosynthesis of G and S Lignin, Guo D, et al, Plant Cell. January; 13(1): 73 (2001) Released HQ 2013 COMT coding sequence Encodes caffeic acid-O-methyl transferase (methylates -OH on C4 of the aromatic ring) from Medicago sativa (alfalfa), synthesised by Geneart false false _123_ 0 1964 9 In stock true Used cDNA as coding gene in Alfalfa genome contains introns. true sarah hollingshead annotation1949817 1 COMT coding region range1949817 1 1 1101 BBa_J15001 1 BBa_J15001 strong synthetic E. coli ribosome binding site with SacI site. 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z Synthetic. This is a strong synthetic E. coli ribosome binding site. It is synthesised as two complementary oligonucleotides rather than being incorporated into a biobrick plasmid. It incorporates a SacI site overlapping the XbaI site, which is preserved when it is added to any other biobrick. This allows easy detection of the RBS after it has been added upstream of a biobrick coding sequence in a plasmid vector. false false _163_ 0 837 163 Not in stock false Note the presence of a SacI site overlapping the XbaI site, which is preserved when this biobrick is added to any other biobrick. At the time of writing, this biobrick is added as a short piece of DNA composed of two complementary oligonucleotides rather than being incorporated into a biobrick cloning vector by itself. It can be added upstream of a biobrick coding sequence, and its presence can easily be detected in miniprep DNA on a gel by using a SacI-SpeI or similar digest. false Chris French annotation1938045 1 SacI range1938045 1 1 3 annotation1938046 1 rbs range1938046 1 4 10 BBa_I742109_sequence 1 ctcaaggaggtactagatgggttcaacaggtgaaactcaaataacaccaacccacatatcagatgaagaagcaaacctcttcgccatgcaactagcaagtgcttcagttcttcccatgattttgaaatcagctcttgaacttgatctcttagaaatcattgctaaagctggacctggtgctcaaatttcacctattgaaattgcttctcagctaccaacaactaaccctgatgcaccagttatgttggaccgaatgttgcgtctcttggcttgttacataatcctcacatgttcagttcgtactcaacaagatggaaaggttcagagactttatggtttggctactgttgctaagtatttggttaagaatgaagatggtgtatccatttctgctcttaatctcatgaatcaggataaagtgctcatggaaagctggtaccacctaaaagatgcagtccttgatgggggcattccattcaacaaggcttatggaatgacagcctttgaataccatggaacagatccaaggtttaacaaggttttcaacaaggggatgtctgatcactctaccatcacaatgaagaaaattcttgagacctacacaggttttgaaggccttaaatctcttgttgatgtaggtggtggtactggagctgtaattaacacgattgtctcaaaatatcccactataaagggtataaattttgatttaccccatgtcattgaagatgctccatcttatccaggagttgagcatgttggtggagacatgtttgtcagtattccaaaggctgatgctgtttttatgaagtggatttgtcatgactggagtgatgagcactgcttgaaatttttgaagaactgctatgaggcactgccagacaatggaaaagtgattgtggcagaatgcatacttccagtggctccagattcaagcctggccacaaaaggtgtggttcacattgatgtgatcatgttggctcataatcctggtgggaaagagagaacacaaaaagagtttgaggatcttgccaaaggtgctggattccaaggtttcaaagtccattgtaatgctttcaacacatacatcatggagtttcttaagaaggtttaataa BBa_I742107_sequence 1 atgggttcaacaggtgaaactcaaataacaccaacccacatatcagatgaagaagcaaacctcttcgccatgcaactagcaagtgcttcagttcttcccatgattttgaaatcagctcttgaacttgatctcttagaaatcattgctaaagctggacctggtgctcaaatttcacctattgaaattgcttctcagctaccaacaactaaccctgatgcaccagttatgttggaccgaatgttgcgtctcttggcttgttacataatcctcacatgttcagttcgtactcaacaagatggaaaggttcagagactttatggtttggctactgttgctaagtatttggttaagaatgaagatggtgtatccatttctgctcttaatctcatgaatcaggataaagtgctcatggaaagctggtaccacctaaaagatgcagtccttgatgggggcattccattcaacaaggcttatggaatgacagcctttgaataccatggaacagatccaaggtttaacaaggttttcaacaaggggatgtctgatcactctaccatcacaatgaagaaaattcttgagacctacacaggttttgaaggccttaaatctcttgttgatgtaggtggtggtactggagctgtaattaacacgattgtctcaaaatatcccactataaagggtataaattttgatttaccccatgtcattgaagatgctccatcttatccaggagttgagcatgttggtggagacatgtttgtcagtattccaaaggctgatgctgtttttatgaagtggatttgtcatgactggagtgatgagcactgcttgaaatttttgaagaactgctatgaggcactgccagacaatggaaaagtgattgtggcagaatgcatacttccagtggctccagattcaagcctggccacaaaaggtgtggttcacattgatgtgatcatgttggctcataatcctggtgggaaagagagaacacaaaaagagtttgaggatcttgccaaaggtgctggattccaaggtttcaaagtccattgtaatgctttcaacacatacatcatggagtttcttaagaaggtttaataa BBa_J15001_sequence 1 ctcaaggagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z