BBa_I742124 1 Plac(rev) Reverse complement Lac promoter 2007-10-21T11:00:00Z 2015-08-31T04:08:02Z This sequence is part of the E.coli K12 genome. This is an 'upside-down' version of I14032. It is a strong, constitual promoter. By adding this part, we wish to emphasise the possibility of engineering both DNA strands, and the additional reglatory possibility that this gives. The upstream sequence is non-functional and simply there to faciliate gel analysis or to physically enable the part to be recomineered (see the Edinburgh 2007 project where it is flanked by dif-sites). false false _123_ 0 1968 9 It's complicated true When dealing with reverse complements of a locus, suffix and prefix need be fitted in opposite order. false Caroline Dahl annotation1955298 1 Plac -35 range1955298 1 61 66 annotation1955267 1 LacI binding site range1955267 1 11 31 annotation1955266 1 CAP binding site range1955266 1 78 115 annotation1955299 1 Plac -10 range1955299 1 38 43 BBa_I742124_sequence 1 ctctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z