BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_I742102 1 difR dif site with reverse orientation 2007-08-07T11:00:00Z 2015-08-31T04:08:02Z E. coli K12 Released HQ 2013 'dif' (division induced filamentation) is the recombination site for XerC and XerD recombinases. Once replicated, aligned direct dif repeats are vital to DNA monomerisation during bacterial septation. As with other recombination sites, inverted repeats cause inversion of the DNA in between. However, XerCD requires activation by FtsK and thus two dif-sites (see also part BBa_I742102) enable recombination that is temporally isolated to division. false false _123_ 0 1965 9 In stock true Synthesised using two oligonucleotides. true Xiaonan Wang annotation1955265 1 dif site (reverse) range1955265 1 4 31 annotation1940993 1 SacI range1940993 1 1 3 BBa_I742124 1 Plac(rev) Reverse complement Lac promoter 2007-10-21T11:00:00Z 2015-08-31T04:08:02Z This sequence is part of the E.coli K12 genome. This is an 'upside-down' version of I14032. It is a strong, constitual promoter. By adding this part, we wish to emphasise the possibility of engineering both DNA strands, and the additional reglatory possibility that this gives. The upstream sequence is non-functional and simply there to faciliate gel analysis or to physically enable the part to be recomineered (see the Edinburgh 2007 project where it is flanked by dif-sites). false false _123_ 0 1968 9 It's complicated true When dealing with reverse complements of a locus, suffix and prefix need be fitted in opposite order. false Caroline Dahl annotation1955298 1 Plac -35 range1955298 1 61 66 annotation1955266 1 CAP binding site range1955266 1 78 115 annotation1955299 1 Plac -10 range1955299 1 38 43 annotation1955267 1 LacI binding site range1955267 1 11 31 BBa_I742128 1 BBa_I742128 Cell replication --> YFP on/off 2007-10-21T11:00:00Z 2015-08-31T04:08:03Z Dif-sites and the Plac are innate E. coli K12 loci. See BBa_E0430 for details about YFP. This device allows recombination at the inverted repeats of the dif-site so that the flanked sequence between (the lac promoter) is inverted and can activate the downstream reporter gene (YFP). It was planned as the proof-of-concept for Edinburgh 2007 project. false false _123_ 0 1968 9 Not in stock false Rumour (unpublished data) has it that the flanked DNA needs be of certain lenght to allow it to form a loop and subsequently invert. 200bp is minimal so the Plac was extended to include nonfunctional LacZ C-terminus. false Caroline Dahl component1952208 1 BBa_I742102 component1952212 1 BBa_B0010 component1952206 1 BBa_I742124 component1952210 1 BBa_B0034 component1952205 1 BBa_I742101 component1952214 1 BBa_B0012 component1952211 1 BBa_E0030 annotation1952211 1 BBa_E0030 range1952211 1 308 1030 annotation1952212 1 BBa_B0010 range1952212 1 1039 1118 annotation1952210 1 BBa_B0034 range1952210 1 290 301 annotation1952205 1 BBa_I742101 range1952205 1 1 31 annotation1952206 1 BBa_I742124 range1952206 1 40 242 annotation1952208 1 BBa_I742102 range1952208 1 251 281 annotation1952214 1 BBa_B0012 range1952214 1 1127 1167 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_E0030 1 eyfp enhanced yellow fluorescent protein derived from A. victoria GFP 2004-03-02T12:00:00Z 2015-08-31T04:07:25Z Modificaitons to Clontech EYFP by Reshma Shetty Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false true Caitlin Conboy and Jennifer Braff BBa_I742101 1 difF dif site with forward orientation 2007-08-07T11:00:00Z 2015-08-31T04:08:02Z E. coli K12 Released HQ 2013 'dif' (division induced filamentation) is the recombination site for XerC and XerD recombinases. Once replicated, aligned direct repeats of the dif site are vital to DNA monomerisation during bacterial septation. As with other recombinase sites, inverted repeats cause inversion of the DNA in between. However, XerCD requires activation by FtsK and thus two dif-sites (see also part BBa_I742102) enables recombination that is temporally isolated to septation. false false _123_ 0 1965 9 In stock true Constructed as two complimentary oligonucleotides. true Xiaonan Wang annotation1955264 1 dif site (forward) range1955264 1 4 31 annotation1940992 1 SacI range1940992 1 1 3 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_I742102_sequence 1 ctcatttaacataatatacattatgcgcacc BBa_E0030_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataa BBa_I742124_sequence 1 ctctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattg BBa_I742101_sequence 1 ctcggtgcgcataatgtatattatgttaaat BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I742128_sequence 1 ctcggtgcgcataatgtatattatgttaaattactagagctctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgtactagagctcatttaacataatatacattatgcgcacctactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z