BBa_I742150 1 BBa_I742150 crtE native rbs 2007-10-23T11:00:00Z 2015-08-31T04:08:03Z Pantoea ananatis (formerly Erwinia uredovora) DSMZ 30080 (ATCC 19321) Accession: D90087. This is the native ribosome binding site of crtE (geranylgeranyl pyrophosphate synthase) from Pantoea ananatis (formerly Erwinia uredovora) DSMZ 30080 (ATCC 19321) Accession: D90087. false false _123_ 0 837 163 Not in stock false This is a virtual part to be added, blunt ended, to the coding sequence. false Chris French BBa_I742150_sequence 1 ctcgcgttgccgtaaatgtatccgtttataaggacagcccga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z