BBa_I742159 1 BBa_I742159 crtI native rbs 2007-10-23T11:00:00Z 2015-08-31T04:08:03Z Pantoea ananatis (formerly Erwinia uredovora) DSMZ 30080 (ATCC 19321). Accession: D90087. Native rbs from crtI (phytoene dehydrogenase) of Pantoea ananatis (formerly Erwinia uredovora) DSMZ 30080 (ATCC 19321). Accession: D90087. false false _123_ 0 837 163 Not in stock false Virtual part to be added to the coding sequence. false Chris French annotation1953816 1 rbs range1953816 1 10 15 BBa_I742159_sequence 1 ctcatcgttaaagagcgactac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z