BBa_I742163 1 BBa_I742163 native ftsK rbs 2007-10-24T11:00:00Z 2015-08-31T04:08:03Z Escherichia coli JM109 (a K12 strain). This is the native ribosome binding site of ftsK, a DNA-translocating motor protein involved in cell division in Escherichia coli. false false _123_ 0 837 163 Not in stock false Virtual part to be added to coding sequence BBa_I742137. false Chris French annotation1954641 1 rbs range1954641 1 15 20 annotation1954640 1 SacI range1954640 1 1 3 BBa_I742163_sequence 1 ctcagcctgtacctggagagcctttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z