BBa_I746000 1 BBa_I746000 AIP generator (agrB + agrD with RBSes) 2007-10-19T11:00:00Z 2015-08-31T04:08:04Z The original sequences for agrB and agrD were taken from the S Aureus Sequencing Project at Oklahoma University (http://www.genome.ou.edu/staph.html). The sequences were then codon-optimised for E. coli using GeneDesigner from DNA2.0 (http://www.dna20.com), and then synthesised by that company. This part was made in order to transfer the S. aureus oligopeptide-based quorum sensing system into a BioBirck-compatible signalling mechanism. In the natural system, the signalling oligopeptide (termed AIP) is made from AgrD by the membrane-located enzyme AgrB. It is then detected by the membrane-located AgrC, which phosphorylates AgrA which then has DNA-binding activity and upregulates transcription of the promoters termed P2 and P3 in the ''agr'' locus. There are four known variants of AIP with different molecular structures and cross-inhibitory activity; this BioBrick generates group I AIP. This part contains the coding regions for group I agrB and agrD (in that order), prefixed by the B0034 RBS and separated by a SaII site. false false _116_ 0 1851 9 Not in stock false N/A false David Wyatt annotation1950179 1 agrB coding sequence range1950179 1 19 591 annotation1950181 1 SaII site range1950181 1 592 597 annotation1950180 1 B0034-sequence RBS range1950180 1 598 609 annotation1950182 1 agrD coding sequence range1950182 1 616 759 annotation1950178 1 B0034-sequence RBS range1950178 1 1 12 BBa_I746000_sequence 1 aaagaggagaaatactagatgaactattttgacaacaagatcgaccaatttgctacttacctgcaaaaacgcaacaacctggaccacatccagtttctgcaagttcgtctgggcatgcaggttctggctaaaaacatcggcaaactgatcgttatgtacaccatcgcctatattctgaacatcttcctgtttaccctgatcaccaacctgaccttctatctgattcgccgtcatgcccacggcgctcatgcaccttcttccttttggtgttatgtagagagcattattctgtttatcctgctgccgctggtaatcgttaacttccacatcaatttcctgattatgatcatcctgactgtgatttccctgggtgtaatctctgtttacgctccggctgccactaagaaaaagccgattccggtgcgcctgatcaaacgtaaaaagtactacgctatcatcgtttccctgaccctgttcattatcaccctgattatcaaagaaccgtttgcacagttcatccagctgggtattatcatcgaagcgatcactctgctgccgatctttttcatcaaagaggatctgaaataataagtcgacaaagaggagaaatactagatgaatactctgttcaatctgtttttcgatttcattactggcatcctgaagaacatcggtaacatcgcagcgtacagcacctgcgacttcatcatggatgaagtagaggtcccgaaagagctgacccagctgcatgaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z