BBa_I746000 1 BBa_I746000 AIP generator (agrB + agrD with RBSes) 2007-10-19T11:00:00Z 2015-08-31T04:08:04Z The original sequences for agrB and agrD were taken from the S Aureus Sequencing Project at Oklahoma University (http://www.genome.ou.edu/staph.html). The sequences were then codon-optimised for E. coli using GeneDesigner from DNA2.0 (http://www.dna20.com), and then synthesised by that company. This part was made in order to transfer the S. aureus oligopeptide-based quorum sensing system into a BioBirck-compatible signalling mechanism. In the natural system, the signalling oligopeptide (termed AIP) is made from AgrD by the membrane-located enzyme AgrB. It is then detected by the membrane-located AgrC, which phosphorylates AgrA which then has DNA-binding activity and upregulates transcription of the promoters termed P2 and P3 in the ''agr'' locus. There are four known variants of AIP with different molecular structures and cross-inhibitory activity; this BioBrick generates group I AIP. This part contains the coding regions for group I agrB and agrD (in that order), prefixed by the B0034 RBS and separated by a SaII site. false false _116_ 0 1851 9 Not in stock false N/A false David Wyatt annotation1950181 1 SaII site range1950181 1 592 597 annotation1950179 1 agrB coding sequence range1950179 1 19 591 annotation1950180 1 B0034-sequence RBS range1950180 1 598 609 annotation1950178 1 B0034-sequence RBS range1950178 1 1 12 annotation1950182 1 agrD coding sequence range1950182 1 616 759 BBa_I746001 1 BBa_I746001 I746000 (AIP generator - agrB + agrD with RBSes) + B0015 (Terminator) 2007-10-22T11:00:00Z 2015-08-31T04:08:04Z The original sequences for agrB and agrD were taken from the S. aureus Sequencing Project at Oklahoma University (http://www.genome.ou.edu/staph.html). The sequences were then codon-optimised for E. coli using GeneDesigner from DNA2.0 (http://www.dna20.com), and then synthesised by that company. Released HQ 2013 This part is simply the AIP generator from the <i>agr</i> system with a standard registry terminator downstream. The original (I746000) part was made in order to transfer the S. aureus oligopeptide-based quorum sensing system into a BioBrick-compatible signalling mechanism. In the natural system, the signalling oligopeptide (termed AIP) is made from AgrD by the membrane-located enzyme AgrB. It is then detected by the membrane-located AgrC, which phosphorylates AgrA which then has DNA-binding activity and upregulates transcription of the promoters termed P2 and P3 in the agr locus. There are four known variants of AIP with different molecular structures and cross-inhibitory activity; this BioBrick generates group I AIP. This part contains the coding regions for group I agrB and agrD (in that order) from S. aureus strain NCTC8325, prefixed by the B0034 RBS and separated by a SaII site. false false _116_ 0 2127 9 In stock false N/A false Lovelace Soirez component1952600 1 BBa_I746000 component1952603 1 BBa_B0012 component1952601 1 BBa_B0010 annotation1952600 1 BBa_I746000 range1952600 1 1 759 annotation1952601 1 BBa_B0010 range1952601 1 768 847 annotation1952603 1 BBa_B0012 range1952603 1 856 896 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I746001_sequence 1 aaagaggagaaatactagatgaactattttgacaacaagatcgaccaatttgctacttacctgcaaaaacgcaacaacctggaccacatccagtttctgcaagttcgtctgggcatgcaggttctggctaaaaacatcggcaaactgatcgttatgtacaccatcgcctatattctgaacatcttcctgtttaccctgatcaccaacctgaccttctatctgattcgccgtcatgcccacggcgctcatgcaccttcttccttttggtgttatgtagagagcattattctgtttatcctgctgccgctggtaatcgttaacttccacatcaatttcctgattatgatcatcctgactgtgatttccctgggtgtaatctctgtttacgctccggctgccactaagaaaaagccgattccggtgcgcctgatcaaacgtaaaaagtactacgctatcatcgtttccctgaccctgttcattatcaccctgattatcaaagaaccgtttgcacagttcatccagctgggtattatcatcgaagcgatcactctgctgccgatctttttcatcaaagaggatctgaaataataagtcgacaaagaggagaaatactagatgaatactctgttcaatctgtttttcgatttcattactggcatcctgaagaacatcggtaacatcgcagcgtacagcacctgcgacttcatcatggatgaagtagaggtcccgaaagagctgacccagctgcatgaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I746000_sequence 1 aaagaggagaaatactagatgaactattttgacaacaagatcgaccaatttgctacttacctgcaaaaacgcaacaacctggaccacatccagtttctgcaagttcgtctgggcatgcaggttctggctaaaaacatcggcaaactgatcgttatgtacaccatcgcctatattctgaacatcttcctgtttaccctgatcaccaacctgaccttctatctgattcgccgtcatgcccacggcgctcatgcaccttcttccttttggtgttatgtagagagcattattctgtttatcctgctgccgctggtaatcgttaacttccacatcaatttcctgattatgatcatcctgactgtgatttccctgggtgtaatctctgtttacgctccggctgccactaagaaaaagccgattccggtgcgcctgatcaaacgtaaaaagtactacgctatcatcgtttccctgaccctgttcattatcaccctgattatcaaagaaccgtttgcacagttcatccagctgggtattatcatcgaagcgatcactctgctgccgatctttttcatcaaagaggatctgaaataataagtcgacaaagaggagaaatactagatgaatactctgttcaatctgtttttcgatttcattactggcatcctgaagaacatcggtaacatcgcagcgtacagcacctgcgacttcatcatggatgaagtagaggtcccgaaagagctgacccagctgcatgaataataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z