BBa_I746104 1 BBa_I746104 P2 promoter in agr operon from S. aureus 2007-08-30T11:00:00Z 2015-08-31T04:08:04Z The section of the sequence constituting the P2 promoter is subject to rather more debate than the sequences of the coding regions. [http://jb.asm.org/cgi/content/full/186/22/7549 Koenig, Robbin L., Ray, Jessica L., Maleki, Soheila J., Smeltzer, Mark S., Hurlburt, Barry K. Staphylococcus aureus AgrA Binding to the RNAIII-agr Regulatory Region J. Bacteriol. 2004 186: 7549-7555] shows the areas of the sequence to which phosphorylated AgrA binds while L Rao, R K Karls, and M J Betley: In vitro transcription of pathogenesis-related genes by purified RNA polymerase from Staphylococcus aureus. Bacteriol. 1995 May; 177(10): 2609???2614. shows the transcription start sites; we took the overall extent of the promoter region from that labelled in Morfeldt, E., K. Tegmark, and S. Arvidson. 1996. Transcriptional control of the agr-dependent virulence gene regulator, RNAIII, in Staphylococcus aureus. Mol. Microbiol. 21:1227???1237. (not available online). Released HQ 2013 The agr P2 operon is an autocatalytic sensory transduction system in Staphylococcus aureus. P2 promoter regulates the synthesis of AgrB (a transmembrane protein) and AgrD (precursor of AIP autoinducing peptide). AIP binds to AgrC, a membrane binding receptor and it phosphorylates AgrA. The phosphorylated AgrA increases the expression level from P2 promoter. false false _116_ 0 2121 9 In stock false Codon usage has been optimised for E. coli (which also seems to give good results for B. subtilis true Zhizhen Zhao BBa_I746104_sequence 1 attaaatacaaattacatttaacagttaagtatttatttcctacagttaggcaatataatgataaaagattgtactaaatcgtataatgacagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z