BBa_I746362 1 BBa_I746362 PP promoter from P2 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z P2 phage genome This is the PP promoter taken from the P2 phage genome. It is an inducible promoter that is activated by a class of activators, including P2 ogr (I746350), PSP3 pag (I746351) and phiR73 delta (I746352). These different activators should cause different levels of activity of the PP promoter. false false _116_ 0 2122 9 It's complicated false no special considerations true Stefan Milde annotation1943785 1 PP range1943785 1 1 92 BBa_I746362_sequence 1 acggcaaggctactgagtcgcgccccgcgattcgctaaggtgctgttgtgtcagtgataagccatccgggactgatggcggaggatgcgcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z