BBa_I746363 1 BBa_I746363 PV promoter from P2 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z P2 phage genome This is the PF promoter taken from the P2 phage genome. It is an inducible promoter that is activated by a class of activators, including P2 ogr (I746350), PSP3 pag (I746351) and phiR73 delta (I746352). These different activators should cause different levels of activity of the PF promoter. false false _116_ 0 2122 9 Not in stock false no special considerations false Stefan Milde annotation1943786 1 PV range1943786 1 1 91 BBa_I746363_sequence 1 ctgaccattacgctctccttgaatgttgtctggtagttctacaaatgaatccagatagcataacttttatatattgtgcaatctcacatgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z