BBa_I746665 1 Pspac-hy Pspac-hy promoter 2007-10-23T11:00:00Z 2015-08-31T04:08:05Z Comes from the pPL82 vector, which is intended as a B. subtilis integrational vector. It is placed in front of the MCS in the plasmid, as it would drive the expression of the gene cloned into the MCS both in B. subtilis and E. coli. There is a G->T point mutation of pSpac at the -1 site, changing the promoter to a stronger one - hence the name pSpac-hy, hy meaning hyper. This promoter drives transcription at rates of about ten times that of the wild type (pSpac) promoter. false false _116_ 0 2119 9 Not in stock false NA false Yue Miao BBa_I746665_sequence 1 ttgactttatctacaaggtgtggcataatgtgtgtaattgtgagcggataacaattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z