BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_I746920 1 BBa_I746920 P7 GFP with 6-his tag 2008-09-29T11:00:00Z 2015-08-31T04:08:05Z The part was obtained by PCR (with primers including the 6-his tag ) of the P7 GFP coding region from part I746904. Coding region of P7 GFP (see part description of I746917 for source and other information about P7 GFP) with C-terminal 6-his tag for assembly into constructs that allow 6-his purification of this GFP variant for in vitro analysis. false false _116_ 0 2122 9 Not in stock false 2 stop codons were removed from the P7 GFP coding region and reinserted after the 6-his tag. false Stefan Milde annotation1977617 1 6-his tag range1977617 1 715 732 annotation1977614 1 start range1977614 1 1 3 annotation1977615 1 stop range1977615 1 733 738 annotation1977616 1 P7 GFP coding region range1977616 1 1 714 BBa_I746907 1 BBa_I746907 T7 promoter driving 6-his tagged P7 GFP 2008-09-30T11:00:00Z 2015-08-31T04:08:05Z The part was created from intermediates via standard assembly. Released HQ 2013 This part is used for purification of P7 GFP (for source and other information about this new GFP variant see its part description: I746917) via its 6-his tag. It is driven by a T7 promoter. We used E.coli BL21 (DE3) for expression of this part: addition of 1mM IPTG leads to expression of the T7 DNA polymerase which in turn drives expression of the tagged P7 GFP. false false _116_ 0 2122 9 In stock false Expression requires T7 DNA polymerase. true Stefan Milde component1978140 1 BBa_I746920 component1978135 1 BBa_B0034 component1978133 1 BBa_I719005 component1978143 1 BBa_B0012 component1978141 1 BBa_B0010 annotation1978140 1 BBa_I746920 range1978140 1 50 787 annotation1978133 1 BBa_I719005 range1978133 1 1 23 annotation1978135 1 BBa_B0034 range1978135 1 32 43 annotation1978143 1 BBa_B0012 range1978143 1 884 924 annotation1978141 1 BBa_B0010 range1978141 1 796 875 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_B0034_sequence 1 aaagaggagaaa BBa_I746920_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgacgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactctcgcgtatggtcttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggtactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgtgttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactttaactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctggaattacacatggcatggatgaactatacaaacatcatcaccatcaccactaataa BBa_I746907_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgacgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactctcgcgtatggtcttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggtactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgtgttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactttaactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctggaattacacatggcatggatgaactatacaaacatcatcaccatcaccactaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z